pLV sgRNA-Hic1 GFP
(Plasmid
#106953)
-
PurposeLentivirus encoding sgRNA targeting murine Hic1. Includes GFP marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106953 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUGW
- Total vector size (bp) 10319
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameanti-Hic1 sgRNA
-
gRNA/shRNA sequenceTTATATCGCGCCAATTCGGG
-
SpeciesM. musculus (mouse), Synthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV sgRNA-Hic1 GFP was a gift from Albert Edge (Addgene plasmid # 106953 ; http://n2t.net/addgene:106953 ; RRID:Addgene_106953) -
For your References section:
Applications of Lgr5-Positive Cochlear Progenitors (LCPs) to the Study of Hair Cell Differentiation. Lenz DR, Gunewardene N, Abdul-Aziz DE, Wang Q, Gibson TM, Edge ASB. Front Cell Dev Biol. 2019 Feb 19;7:14. doi: 10.3389/fcell.2019.00014. eCollection 2019. 10.3389/fcell.2019.00014 PubMed 30873406