Skip to main content
Addgene

pLV sgRNA-Notch1 #2 GFP
(Plasmid #106951)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106951 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    FUGW
  • Total vector size (bp) 10318
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA targeting Notch1
  • gRNA/shRNA sequence
    GTGTGTGAGTACCGCCCCTG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Notch1 (a.k.a. 9930111A19Rik, Mis6, N1, Tan1, lin-12)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV sgRNA-Notch1 #2 GFP was a gift from Albert Edge (Addgene plasmid # 106951 ; http://n2t.net/addgene:106951 ; RRID:Addgene_106951)
  • For your References section:

    Applications of Lgr5-Positive Cochlear Progenitors (LCPs) to the Study of Hair Cell Differentiation. Lenz DR, Gunewardene N, Abdul-Aziz DE, Wang Q, Gibson TM, Edge ASB. Front Cell Dev Biol. 2019 Feb 19;7:14. doi: 10.3389/fcell.2019.00014. eCollection 2019. 10.3389/fcell.2019.00014 PubMed 30873406