gh125
(Plasmid
#106795)
-
Purposeexpression of gRNA targeting ST8SIA5
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backboneEPB104
-
Backbone manufacturerEric-Paul Bennett (Addgene plasmid # 68369)
- Backbone size w/o insert (bp) 2376
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameST8SIA5
-
gRNA/shRNA sequenceATACAGGATCTGTTGCAGCA
-
SpeciesH. sapiens (human)
-
Entrez GeneST8SIA5 (a.k.a. SIAT8-E, SIAT8E, ST8SiaV)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer T7NP (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gh125 was a gift from Eric-Paul Bennett (Addgene plasmid # 106795 ; http://n2t.net/addgene:106795 ; RRID:Addgene_106795) -
For your References section:
A validated gRNA library for CRISPR/Cas9 targeting of the human glycosyltransferase genome. Narimatsu Y, Joshi HJ, Zhang Y, Gomes C, Chen YH, Lorenzetti F, Furukawa S, Schjoldager K, Hansen L, Clausen H, Bennett EP, Wandall HH. Glycobiology. 2018 Jan 5. pii: 4791732. doi: 10.1093/glycob/cwx101. 10.1093/glycob/cwx101 PubMed 29315387
