gh118
(Plasmid
#106788)
-
Purposeexpression of gRNA targeting GCNT4
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106788 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEPB104
-
Backbone manufacturerEric-Paul Bennett (Addgene plasmid # 68369)
- Backbone size w/o insert (bp) 2376
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGCNT4
-
gRNA/shRNA sequenceGCAGCCATAGGGTTAAAAAC
-
SpeciesH. sapiens (human)
-
Entrez GeneGCNT4 (a.k.a. C2GNT3, LINC01336)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer T7NP (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gh118 was a gift from Eric-Paul Bennett (Addgene plasmid # 106788 ; http://n2t.net/addgene:106788 ; RRID:Addgene_106788) -
For your References section:
A validated gRNA library for CRISPR/Cas9 targeting of the human glycosyltransferase genome. Narimatsu Y, Joshi HJ, Zhang Y, Gomes C, Chen YH, Lorenzetti F, Furukawa S, Schjoldager K, Hansen L, Clausen H, Bennett EP, Wandall HH. Glycobiology. 2018 Jan 5. pii: 4791732. doi: 10.1093/glycob/cwx101. 10.1093/glycob/cwx101 PubMed 29315387