pSV40-GUS-P2A-Hygro
(Plasmid #106480)

• Purpose: Expression of GUS and Hygromycin resistance gene from SV40 promoter
• Depositing Lab: Alex Hewitt
• Publication: pSV40 expression constructs (unpublished)

Backbone

• Vector backbone: pSV40
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 3756
• Total vector size (bp): 5556
• Vector type: Mammalian Expression, Plant Expression
• Selectable markers: Neomycin (select with G418), Hygromycin ; GUS

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: beta-glucuronidase
• Alt name: GUS
• Insert Size (bp): 1809
• Promoter: SV40 promoter

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tatttatgcagaggccgagg

Gene/Insert 2

• Gene/Insert name: Hygromycin B resistance
• Species: Streptomyces hygroscopicus
• Insert Size (bp): 1026
• Promoter: SV40 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tatttatgcagaggccgagg

Resource Information

• Supplemental Documents:
  • gibass-psv40-gus-p2a-hygro.gb
• A portion of this plasmid was derived from a plasmid made by: GUS gene cloned from the p2R3a-GUS-OcsT construct from Ari Pekka Mahonen Lab. (Addgene#71267)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry