pSV40-mCherry-P2A-Hygro
(Plasmid #106478)

• Purpose: Expression of mCherry and Hygromycin resistance gene from SV40 promoter
• Depositing Lab: Alex Hewitt
• Publication: pSV40 expression constructs (unpublished)

Backbone

• Vector backbone: pSV40
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 3756
• Total vector size (bp): 5556
• Vector type: Mammalian Expression, Plant Expression
• Selectable markers: Hygromycin ; mCherry

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 708
• Promoter: SV40 promoter

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tatttatgcagaggccgagg

Gene/Insert 2

• Gene/Insert name: Hygromycin B resistance
• Species: Streptomyces hygroscopicus
• Insert Size (bp): 1026
• Promoter: SV40 promoter

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tatttatgcagaggccgagg

Resource Information

• Supplemental Documents:
  • gibass-psv40-mcherry-p2a-hygro (1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry