-
PurposeGuide RNA plasmid targeting lvaA on BBR1-UP origin
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepBbB1k-GFP
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Tetracycline, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA towards lvaA in Pseudomonas putida
-
gRNA/shRNA sequencegtcagtgctagctcgagcga
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaaac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pgRNAtet-lvaA was a gift from Brian Pfleger (Addgene plasmid # 106397 ; http://n2t.net/addgene:106397 ; RRID:Addgene_106397) -
For your References section:
Genetic tools for reliable gene expression and recombineering in Pseudomonas putida. Cook TB, Rand JM, Nurani W, Courtney DK, Liu SA, Pfleger BF. J Ind Microbiol Biotechnol. 2018 Jan 3. pii: 10.1007/s10295-017-2001-5. doi: 10.1007/s10295-017-2001-5. 10.1007/s10295-017-2001-5 [pii] PubMed 29299733
