-
PurposeC. difficile transposon mutagenesis system. Shuttle vector containing tet-inducible Himar1 transposase and custom ErmR transposon
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMTL960
- Backbone size w/o insert (bp) 6191
- Total vector size (bp) 9231
-
Vector typeE. coli - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 15 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLow copy in C. difficile following conjugation and selected with thiamphenicol
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePtet-himar1-Ter(slpA)-transposon
-
Insert Size (bp)3040
-
MutationCodon optimised for C. difficile
- Promoter Ptet
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BstXI (not destroyed)
- 5′ sequencing primer CACCTCCTTTTTGACTTTAAGCCTACGAATACC
- 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRPF215 was a gift from Robert Fagan & Neil Fairweather (Addgene plasmid # 106377 ; http://n2t.net/addgene:106377 ; RRID:Addgene_106377) -
For your References section:
High-throughput analysis of gene essentiality and sporulation in Clostridium difficile. Dembek M, Barquist L, Boinett CJ, Cain AK, Mayho M, Lawley TD, Fairweather NF, Fagan RP. MBio. 2015 Feb 24;6(2):e02383. doi: 10.1128/mBio.02383-14. 10.1128/mBio.02383-14 PubMed 25714712