pRPF144
(Plasmid
#106372)
-
PurposeC. difficile constitutive expression system. Shuttle plasmid containing constitutive Pcwp2 -gusA
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106372 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMTL960
- Backbone size w/o insert (bp) 6218
- Total vector size (bp) 8258
-
Vector typeE. coli - C. difficile shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 15 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLow copy in C. difficile following conjugation and selected with thiamphenicol
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePcwp2-gusA
-
Insert Size (bp)2040
-
Mutationcodon optimised for C. difficile
-
Entrez GenegusA (a.k.a. ECO111_2086)
- Promoter Pcwp2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CACCTCCTTTTTGACTTTAAGCCTACGAATACC
- 3′ sequencing primer CACCGACGAGCAAGGCAAGACCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRPF144 was a gift from Robert Fagan & Neil Fairweather (Addgene plasmid # 106372 ; http://n2t.net/addgene:106372 ; RRID:Addgene_106372) -
For your References section:
Clostridium difficile has two parallel and essential Sec secretion systems. Fagan RP, Fairweather NF. J Biol Chem. 2011 Aug 5;286(31):27483-93. doi: 10.1074/jbc.M111.263889. Epub 2011 Jun 9. 10.1074/jbc.M111.263889 PubMed 21659510