Phi3-iRFP
(Plasmid #106296)

• Purpose: CMV driven iRFP with n terminal membrane binding domain of GAP43
• Depositing Lab: Sanford Simon
• Publication: Belote et al J Cell Biol. 2020 Jan 6;219(1). pii: 132739. doi: 10.1083/jcb.201902014.

Backbone

• Vector backbone: PLVX Puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 8167
• Total vector size (bp): 9175
• Modifications to backbone: MCS was modified as described in Takacs, C.N., et al., (2017) Traffic 18, 192-204.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: iRFPmem
• Alt name: membrane bound iRFP
• Insert Size (bp): 1011
• Promoter: CMV

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCGCATGCTCCAGACTGCC

Resource Information

• Supplemental Documents:
  • 106296phi3-irfpmem.gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: iRFP is from Vladislav Verkhusha, addgene plasmid # 31857

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry