Zhi3-mCherry
(Plasmid #106295)

• Purpose: CMV driven mCherry, zeocin resistance
• Depositing Lab: Sanford Simon
• Publication: Belote et al J Cell Biol. 2020 Jan 6;219(1). pii: 132739. doi: 10.1083/jcb.201902014.

Backbone

• Vector backbone: PLVX Puro
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 7891
• Total vector size (bp): 8601
• Modifications to backbone: MCS was modified as described in Takacs, C.N., et al., (2017) Traffic 18, 192-204. puromycin resistance gene was replaced with zeocin resistance gene.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Insert Size (bp): 710
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: MluI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GCGCATGCTCCAGACTGCC

Resource Information

• Supplemental Documents:
  • 106295zhi3-mcherry.gb
• A portion of this plasmid was derived from a plasmid made by: Clontech, Cat# pmCherry-N1

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry