Skip to main content
Addgene

Zhi3-mCherry
(Plasmid #106295)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106295 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PLVX Puro
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7891
  • Total vector size (bp) 8601
  • Modifications to backbone
    MCS was modified as described in Takacs, C.N., et al., (2017) Traffic 18, 192-204. puromycin resistance gene was replaced with zeocin resistance gene.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    710
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GCGCATGCTCCAGACTGCC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Clontech, Cat# pmCherry-N1

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Zhi3-mCherry was a gift from Sanford Simon (Addgene plasmid # 106295 ; http://n2t.net/addgene:106295 ; RRID:Addgene_106295)
  • For your References section:

    Ca2+ transients in melanocyte dendrites and dendritic spine-like structures evoked by cell-to-cell signaling. Belote RL, Simon SM. J Cell Biol. 2020 Jan 6;219(1). pii: 132739. doi: 10.1083/jcb.201902014. 10.1083/jcb.201902014 PubMed 31821412