pLS-SV40-mP-Rluc
(Plasmid
#106292)
-
PurposeLuciferase lentivirus based enhancer assay vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106292 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepLS-SV40-mP
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 8385
-
Vector typeLentiviral, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuciferase
-
SpeciesRenilla
-
Insert Size (bp)932
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTCTTGTGTATATCCGGTC
- 3′ sequencing primer AAGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLS-SV40-mP-Rluc was a gift from Nadav Ahituv (Addgene plasmid # 106292 ; http://n2t.net/addgene:106292 ; RRID:Addgene_106292)
