pSBbi-FoxO1_1R_13A_3D
(Plasmid #106279)

• Purpose: Fluorescent fusion protein for FoxO1
• Depositing Lab: Laura Heiser
• Publication: Gross et al Cell Syst. 2019 Dec 18;9(6):580-588.e4. doi: 10.1016/j.cels.2019.11.005. Epub 2019 Dec 11.

Backbone

• Vector backbone: pSBbi-RP
• Backbone size w/o insert (bp): 6625
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Foxo1a
• Species: M. musculus (mouse)
• Insert Size (bp): 1900
• Mutation: Deleted amino acids 401-636, T24A, S209A, H212R, S215A, S246A, S253A, S284A, S295A, S298A, S300A, S316A, L325D, S325D, P325D, S380A, S391A, T399A
• Entrez Gene: Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
• Promoter: EF1a/RPBSA
• Tag / Fusion Protein:
  • Clover fluorescent protein (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: - (unknown if destroyed)
• 3′ cloning site: - (unknown if destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC

Gene/Insert 2

• Gene/Insert name: NLS-mCherry-NLS-P2A-Puromycin
• Insert Size (bp): 1450
• Promoter: EF1a/RPBSA
• Tag / Fusion Protein:
  • NLS (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: - (unknown if destroyed)
• 3′ cloning site: - (unknown if destroyed)
• 5′ sequencing primer: 1

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2018/07/21/373993 for BioRxiv preprint