Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSBbi-FoxO1_1R_10A_3D
(Plasmid #106278)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106278 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSBbi-RP
  • Backbone size w/o insert (bp) 6625
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Foxo1a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1900
  • Mutation
    Deleted amino acids 401-636, S209A, H212R, S215A, S246A, S284A, S295A, S298A, S300A, L325D, S326D, P327D, S380A, S391A, T399A
  • Entrez Gene
    Foxo1 (a.k.a. Afxh, FKHR, Fkhr1, Foxo1a)
  • Promoter EF1a/RPBSA
  • Tag / Fusion Protein
    • Clover fluorescent protein (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site - (unknown if destroyed)
  • 3′ cloning site - (unknown if destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    NLS-mCherry-NLS-P2A-Puromycin
  • Insert Size (bp)
    1450
  • Promoter EF1a/RPBSA

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site - (unknown if destroyed)
  • 3′ cloning site - (unknown if destroyed)
  • 5′ sequencing primer 1
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-FoxO1_1R_10A_3D was a gift from Laura Heiser (Addgene plasmid # 106278 ; http://n2t.net/addgene:106278 ; RRID:Addgene_106278)
  • For your References section:

    Individual Cells Can Resolve Variations in Stimulus Intensity along the IGF-PI3K-AKT Signaling Axis. Gross SM, Dane MA, Bucher E, Heiser LM. Cell Syst. 2019 Dec 18;9(6):580-588.e4. doi: 10.1016/j.cels.2019.11.005. Epub 2019 Dec 11. 10.1016/j.cels.2019.11.005 PubMed 31838146