pZA-YFP-R5
(Plasmid
#106257)
-
PurposeExpresses Venus YFP fused with silaffin-R5 silica affinity peptide under the control of TetO
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106257 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZA31
-
Backbone manufacturerexpressys
- Backbone size w/o insert (bp) 2828
- Total vector size (bp) 2009
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameYellow fluorescent protein
-
Alt nameYFP
-
Insert Size (bp)819
- Promoter pL-TetO
-
Tag
/ Fusion Protein
- Added silaffin R5 peptide to C terminus of YFP after 3xGGGGS linker (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATACGCCCGGTAGTGATCTT
- 3′ sequencing primer GGCCCTCTCACTTCCCTGTTAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZA-YFP-R5 was a gift from Urartu Seker (Addgene plasmid # 106257 ; http://n2t.net/addgene:106257 ; RRID:Addgene_106257) -
For your References section:
Autonomous Synthesis of Fluorescent Silica Biodots Using Engineered Fusion Proteins. Olmez TT, Yuca E, Eyupoglu E, Catalak HB, Sahin O, Seker UOS. ACS Omega. 2018 Jan 31;3(1):585-594. doi: 10.1021/acsomega.7b01769. Epub 2018 Jan 18. 10.1021/acsomega.7b01769 PubMed 30023783