pZA-GFP-R5
(Plasmid
#106256)
-
PurposeConstitutively expresses GFP fused with silaffin-R5 silica affinity peptide
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106256 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepZA
-
Backbone manufacturerexpressys
- Backbone size w/o insert (bp) 2091
- Total vector size (bp) 2880
-
Modifications to backbonePromoter replaced by constitutively active promoter proD
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGreen fluorescent protein
-
Alt nameGFP
-
Insert Size (bp)789
-
Tag
/ Fusion Protein
- Added silaffin R5 peptide to C terminus of GFP after GGGGS linker (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTTCGCCAGATATCGACGTCT
- 3′ sequencing primer CGTTCGTAAGCCATTTCCGCTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZA-GFP-R5 was a gift from Urartu Seker (Addgene plasmid # 106256 ; http://n2t.net/addgene:106256 ; RRID:Addgene_106256) -
For your References section:
Autonomous Synthesis of Fluorescent Silica Biodots Using Engineered Fusion Proteins. Olmez TT, Yuca E, Eyupoglu E, Catalak HB, Sahin O, Seker UOS. ACS Omega. 2018 Jan 31;3(1):585-594. doi: 10.1021/acsomega.7b01769. Epub 2018 Jan 18. 10.1021/acsomega.7b01769 PubMed 30023783
