Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLS-mP-Luc
(Plasmid #106253)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 106253 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLS-mP
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 8750
  • Vector type
    Lentiviral, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Luciferase
  • Species
    Firefly
  • Insert Size (bp)
    1700

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCTTCTTGTGTATATCCGGTC
  • 3′ sequencing primer AAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There is an anti-repressor element (called #40) between the BstXI and XbaI, which prevents the expression cassette from position effect. See the manually annotated plasmid map for pLS-mP (https://www.addgene.org/81225/) Please use XbaI and/or SbfI for enhancer cloning.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLS-mP-Luc was a gift from Nadav Ahituv (Addgene plasmid # 106253 ; http://n2t.net/addgene:106253 ; RRID:Addgene_106253)