pUPD2b:TMV-3NTR
(Plasmid
#106218)
-
PurposeProvides Nos terminator and 3' part of Tobacco mosaic virus (3NTR, ribozyme) as level 0 GoldenBraid part (GCTT-CGCT)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUPD1
-
Backbone manufacturerGoldenBraid kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
- Backbone size w/o insert (bp) 3047
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInfectious clone of Tobacco mosaic virus, 3' part
-
Alt nameTMV
-
Alt nameviral expression vector
-
SpeciesSynthetic
-
Insert Size (bp)714
-
MutationBsaI and BsmBI sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CCCGATCAACTCGAGTGCCA
- 3′ sequencing primer GAGGAAGCCTGCATAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUPD2b:TMV-3NTR was a gift from Tomáš Moravec (Addgene plasmid # 106218 ; http://n2t.net/addgene:106218 ; RRID:Addgene_106218)