pUPD2:35S-TMV-Rep-MP
(Plasmid
#106217)
-
PurposeProvides CaMV 35S and 5' part of Tobacco mosaic virus (RdRp polymerase with intron, movement protein and sgCP promoter) as level 0 GoldenBraid part (GGAG-AATG)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106217 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUPD2
-
Backbone manufacturerGoldenBraid kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
- Backbone size w/o insert (bp) 2100
-
Vector typePlant Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInfectious clone of Tobacco mosaic virus, 5' part
-
Alt nameTMV
-
Alt nameviral expression vector
-
SpeciesSynthetic
-
Insert Size (bp)6622
-
MutationBsaI and BsmBI sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CCCGATCAACTCGAGTGCCA
- 3′ sequencing primer GAGGAAGCCTGCATAACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUPD2:35S-TMV-Rep-MP was a gift from Tomáš Moravec (Addgene plasmid # 106217 ; http://n2t.net/addgene:106217 ; RRID:Addgene_106217)