pLenti- V6.3 Ultra
(Plasmid #106172)

• Purpose: lentiviral CMV driven eGFP-P2A-T2A, Blasticidin selectable
• Depositing Lab: Ewa Snaar-Jagalska
• Publication: CMV eGFP-P2A-T2A, blasticidin selectable (unpublished)

Backbone

• Vector backbone: pLenti6.3/TO/V5-DEST
• Backbone manufacturer: invitrogen
• Backbone size w/o insert (bp): 9351
• Total vector size (bp): 8656
• Modifications to backbone: pUltra-eGFP and P2A-T2A MCS cloned into pLenti 6.3 (through in-fusion cloning, linearized through PstI and SalI digestion, restriction sites maintained)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Species: Synthetic
• Insert Size (bp): 717
• Promoter: CMV
• Tag / Fusion Protein:
  • T2A, P2A

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: TTGGTCACCTTCAGCTTGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: insert derived from pUltra (Plasmid #24129)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry