px458_2A_GFP_sgRNA_PRKRA
(Plasmid
#106109)
-
PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting PRKRA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106109 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepx458
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA targeting PRKRA
-
gRNA/shRNA sequenceAGATGATAACAGCTAAGCCA
-
SpeciesH. sapiens (human)
-
Entrez GenePRKRA (a.k.a. DYT16, HSD14, PACT, RAX)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
px458_2A_GFP_sgRNA_PRKRA was a gift from Thomas Tuschl (Addgene plasmid # 106109 ; http://n2t.net/addgene:106109 ; RRID:Addgene_106109) -
For your References section:
The TIA1 RNA-Binding Protein Family Regulates EIF2AK2-Mediated Stress Response and Cell Cycle Progression. Meyer C, Garzia A, Mazzola M, Gerstberger S, Molina H, Tuschl T. Mol Cell. 2018 Feb 15;69(4):622-635.e6. doi: 10.1016/j.molcel.2018.01.011. 10.1016/j.molcel.2018.01.011 PubMed 29429924