hMLKL-Venus-Plasma
(Plasmid #106081)

• Purpose: expression in mammalian cells
• Depositing Lab: Douglas Green
• Publication: Quarato et al Mol Cell. 2016 Feb 18;61(4):589-601. doi: 10.1016/j.molcel.2016.01.011. Epub 2016 Feb 4.

Backbone

• Vector backbone: pRetrX-TRE3G
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 6600
• Total vector size (bp): 8801
• Vector type: Mammalian Expression, Retroviral ; Tet-On retrovirus
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: hMLKL-Venus-Plasma
• Alt name: plasma membrane-targeted human MLKL
• Alt name: hMLKL-Venus-HRas25
• Species: H. sapiens (human)
• Insert Size (bp): 2239
• GenBank ID: NM_152649.3
• Entrez Gene: MLKL (a.k.a. hMLKL)
• Promoter: dox-inducible
• Tag / Fusion Protein:
  • plasma membrane-targetting domain of H-Ras (aa 1-25) (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: ClaI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: ACCATGGAAAATTTGAAGCAT
• 3′ sequencing primer: GAATTCTCAGGAGAGCACACAC

Resource Information

• Supplemental Documents:
  • PF4372

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry