Cerulean-2xFv-hRIPK3
(Plasmid
#106079)
-
Purposeexpression in mammalian cells
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106079 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMSCV
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersFACS sort for Cerulean
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCerulean-2xFv-hRIPK3
-
Alt nameoligomerizable human RIPK3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2950
-
GenBank IDNM_006871.3
-
Entrez GeneRIPK3 (a.k.a. RIP3)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer AGATCTACCATGGTGAGCAAGGGCGAGGAG
- 3′ sequencing primer GTCGACTTATTTCCCGCTATGATTATA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cerulean-2xFv-hRIPK3 was a gift from Douglas Green (Addgene plasmid # 106079 ; http://n2t.net/addgene:106079 ; RRID:Addgene_106079) -
For your References section:
Sequential Engagement of Distinct MLKL Phosphatidylinositol-Binding Sites Executes Necroptosis. Quarato G, Guy CS, Grace CR, Llambi F, Nourse A, Rodriguez DA, Wakefield R, Frase S, Moldoveanu T, Green DR. Mol Cell. 2016 Feb 18;61(4):589-601. doi: 10.1016/j.molcel.2016.01.011. Epub 2016 Feb 4. 10.1016/j.molcel.2016.01.011 PubMed 26853145