Opto-GPR37
(Plasmid
#106019)
-
PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR37; Opto-GPR37; B9)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 106019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1-
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5427
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOpto-GPR37
-
SpeciesH. sapiens (human), B. taurus (bovine)
-
Insert Size (bp)1239
-
MutationChimeric receptor protein
-
Entrez GeneGPR37 (a.k.a. EDNRBL, PAELR, hET(B)R-LP)
- Promoter CMV
-
Tags
/ Fusion Proteins
- VSV-G (N terminal on insert)
- Rhodopsin-1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV_F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer pcDNA_R (CAACAGATGGCTGGCAAC) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
two step cloning; 5' and 3' sites cannot be used for (sub)cloning
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Opto-GPR37 was a gift from Harald Janovjak (Addgene plasmid # 106019 ; http://n2t.net/addgene:106019 ; RRID:Addgene_106019) -
For your References section:
Optical functionalization of human Class A orphan G-protein-coupled receptors. Morri M, Sanchez-Romero I, Tichy AM, Kainrath S, Gerrard EJ, Hirschfeld PP, Schwarz J, Janovjak H. Nat Commun. 2018 May 16;9(1):1950. doi: 10.1038/s41467-018-04342-1. 10.1038/s41467-018-04342-1 PubMed 29769519