pAID 1.1C-T2A-Bsr
(Plasmid
#105986)
-
PurposeTo make an auxin inducible degron mutant
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAID1.1-C
- Backbone size w/o insert (bp) 7450
- Total vector size (bp) 7589
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418), Blasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsE.coli growth is slow
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameT2A-Bsr
-
SpeciesSynthetic
-
Insert Size (bp)477
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCATGGAGATCTGCCTAAAGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAID 1.1C-T2A-Bsr was a gift from Tatsuo Fukagawa (Addgene plasmid # 105986 ; http://n2t.net/addgene:105986 ; RRID:Addgene_105986) -
For your References section:
An efficient method to generate conditional knockout cell lines for essential genes by combination of auxin-inducible degron tag and CRISPR/Cas9. Nishimura K, Fukagawa T. Chromosome Res. 2017 Oct;25(3-4):253-260. doi: 10.1007/s10577-017-9559-7. Epub 2017 Jun 6. 10.1007/s10577-017-9559-7 [pii] PubMed 28589221