pFUSEss-CHIg-mG3_CH3-1
(Plasmid
#105859)
-
PurposeExpression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH3.
-
Depositing Lab
-
Sequence Information
-
Sequences (2) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105859 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUSEss-CHIg-mG3 (modified)
-
Backbone manufacturerInvivogen
- Backbone size w/o insert (bp) 4477
- Total vector size (bp) 4832
-
Modifications to backbonehybrid heavy chain of mouse IgG3 with CH3 derived from mouse IgG1
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site AfeI (not destroyed)
- 5′ sequencing primer ATGTACAGGATGCAACTCCTG
- 3′ sequencing primer EBV-rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUSEss-CHIg-mG3_CH3-1 was a gift from Joanna Bereta (Addgene plasmid # 105859 ; http://n2t.net/addgene:105859 ; RRID:Addgene_105859) -
For your References section:
CH2 Domain of Mouse IgG3 Governs Antibody Oligomerization, Increases Functional Affinity to Multivalent Antigens and Enhances Hemagglutination. Klaus T, Bereta J. Front Immunol. 2018 May 23;9:1096. doi: 10.3389/fimmu.2018.01096. eCollection 2018. 10.3389/fimmu.2018.01096 PubMed 29875771