pFUSEss-CHIg-mG3_CH3-1
(Plasmid #105859)

• Purpose: Expression plasmid coding for hybrid heavy chain of mouse IgG3 antibody specific to antigen B of the ABO blood group system, clone M18. The antibody comprises IgG1-derived CH3.
• Depositing Lab: Joanna Bereta
• Publication: Klaus et al Front Immunol. 2018 May 23;9:1096. doi: 10.3389/fimmu.2018.01096. eCollection 2018.

Backbone

• Vector backbone: pFUSEss-CHIg-mG3 (modified)
• Backbone manufacturer: Invivogen
• Backbone size w/o insert (bp): 4477
• Total vector size (bp): 4832
• Modifications to backbone: hybrid heavy chain of mouse IgG3 with CH3 derived from mouse IgG1
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IgG1, IgG3
• Alt name: Ighg3
• Alt name: Ighg1
• Species: M. musculus (mouse)
• Mutation: hybrid heavy chain of mouse IgG3 with CH3 derived from mouse IgG1
• Entrez Gene: Ighg1 (a.k.a. IgG1, Igh-4, VH7183)
• Entrez Gene: Ighg3 (a.k.a. IgG3)
• Promoter: hEF1-HTLV prom

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: AfeI (not destroyed)
• 5′ sequencing primer: ATGTACAGGATGCAACTCCTG
• 3′ sequencing primer: EBV-rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry