-
PurposeDonor construct for introduction of hNIL factors and SBP-LNGFR for streptavidin bead enrichment
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105842 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUCM
-
Backbone manufacturercustom
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 14168
-
Modifications to backboneCLYBL homology arms
-
Vector typeCRISPR, TALEN
-
Selectable markersPuromycin ; SBP-LNGFR for bead selection
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameNeurogenin 2
-
Alt nameNGN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)819
-
GenBank IDNM_024019
-
Entrez GeneNEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
- Promoter TRE3G
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameISL LIM Homeobox 1
-
Alt nameISL1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1050
-
GenBank IDNM_002202
-
Entrez GeneISL1 (a.k.a. ISLET1, Isl-1)
- Promoter TRE3G
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGCCTGCTGAAGCAGGCTGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameLIM Homeobox 3
-
Alt nameLHX3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1209
-
Entrez GeneLHX3 (a.k.a. CPHD3, LIM3, M2-LHX3)
- Promoter TRE3G
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGCATGGTAGCCAGTCCTATTG
- 3′ sequencing primer TGTGGAATTGTGAGCGGATA (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameOptimized mApple
-
Alt nameOptimized mApple
-
SpeciesSynthetic
-
Insert Size (bp)708
- Promoter EF-1alpha
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagaggaagtcttctaacatg (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert namertTA3G
-
Alt namertTA3G
-
Insert Size (bp)747
- Promoter CAG
Cloning Information for Gene/Insert 5
- Cloning method Unknown
- 5′ sequencing primer ctggttattgtgctgtctc (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameSBP Delta-LNGFR
-
Alt nameSBP Delta-LNGFR
-
Insert Size (bp)738
- Promoter EF-1alpha
Cloning Information for Gene/Insert 6
- Cloning method Gibson Cloning
- 5′ sequencing primer gtgaccggcgcctacgctag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byTre3G and rTTA are from Clontech Plasmid (TetOne Lenti Vector)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CLYBL-(Ef1a-SBP-LNGFR-T2A-mApple)-(CAG-rtTA)-(TRE-hNIL)) was a gift from Michael Ward (Addgene plasmid # 105842 ; http://n2t.net/addgene:105842 ; RRID:Addgene_105842) -
For your References section:
Transcription Factor-Mediated Differentiation of Human iPSCs into Neurons. Fernandopulle MS, Prestil R, Grunseich C, Wang C, Gan L, Ward ME. Curr Protoc Cell Biol. 2018 Jun;79(1):e51. doi: 10.1002/cpcb.51. Epub 2018 May 18. 10.1002/cpcb.51 PubMed 29924488