pUCM-AAVS1-TO-hNGN2
(Plasmid #105840)

• Purpose: Donor construct for introduction of NGN2 into AAVS1 safe harbor site and iPSC differentiation to cortical neuron
• Depositing Lab: Michael Ward
• Publication: Fernandopulle et al Curr Protoc Cell Biol. 2018 Jun;79(1):e51. doi: 10.1002/cpcb.51. Epub 2018 May 18.

Backbone

• Vector backbone: pUCM
• Backbone manufacturer: custom
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 10618
• Modifications to backbone: AAVS1 homology arms
• Vector type: CRISPR, TALEN
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Neurogenin 2
• Alt name: NGN2
• Species: H. sapiens (human)
• Insert Size (bp): 819
• GenBank ID: NM_024019
• Entrez Gene: NEUROG2 (a.k.a. Atoh4, Math4A, NGN2, bHLHa8, ngn-2)
• Promoter: TRE3G

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTCGTTTAGTGAACCGTCAG

Gene/Insert 2

• Gene/Insert name: mCherry
• Alt name: mcherry
• Species: Synthetic
• Insert Size (bp): 702
• Promoter: EF-1alpha

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: gcgcctacgctagcgctac

Gene/Insert 3

• Gene/Insert name: rtTA3G
• Alt name: rtTA3G
• Insert Size (bp): 747
• Promoter: CAG

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: ctggttattgtgctgtctc

Resource Information

• Supplemental Documents:
  • pUCM-AAVS1-TO-hNGN2 .gb
• Addgene Notes:
  • Addgene Diagnostic Digest
• A portion of this plasmid was derived from a plasmid made by: Tre3G and rTTA are from Clontech Plasmid (TetOne Lenti Vector)
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
  • Tet Systems Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that this plasmid may runs as a dimer (>21kb). Concatenation/Dimerization often does not impact plasmid function, but may reduce transformation efficiencies. You may need to screen multiple colonies to isolate the monomeric version of this plasmid. If you still have trouble isolating the monomeric version, you might consider linearizing, gel extracting, re-ligating, and transforming the plasmid.