Skip to main content
Addgene

pT7-7 asyn G51D
(Plasmid #105747)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105747 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pT7-7
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    alpha-synuclein G51D
  • Species
    H. sapiens (human)
  • Mutation
    G51D
  • Entrez Gene
    SNCA (a.k.a. NACP, PARK1, PARK4, PD1)
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGG)
  • 3′ sequencing primer AmpStop (TCAGGCAACTATGGATGAAC)
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-7 asyn G51D was a gift from Hilal Lashuel (Addgene plasmid # 105747 ; http://n2t.net/addgene:105747 ; RRID:Addgene_105747)

  • For your References section:

    The novel Parkinson's disease linked mutation G51D attenuates in vitro aggregation and membrane binding of alpha-synuclein, and enhances its secretion and nuclear localization in cells. Fares MB, Ait-Bouziad N, Dikiy I, Mbefo MK, Jovicic A, Kiely A, Holton JL, Lee SJ, Gitler AD, Eliezer D, Lashuel HA. Hum Mol Genet. 2014 Sep 1;23(17):4491-509. doi: 10.1093/hmg/ddu165. Epub 2014 Apr 11. 10.1093/hmg/ddu165 PubMed 24728187
Related items:
Commonly requested with: