pmGFP-P2A-K(AAA)20-P2A-RFP
(Plasmid #105688)

• Purpose: Double fluorescent stalling reporter K(AAA)20
• Depositing Lab: Ramanujan Hegde
• Publication: Juszkiewicz et al Mol Cell. 2017 Feb 16;65(4):743-750.e4. doi: 10.1016/j.molcel.2016.11.039. Epub 2017 Jan 5.

Backbone

• Vector backbone: pEGFP-N1
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 6030
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: P2A-3xFLAG-VHPbeta
• Species: Synthetic
• Insert Size (bp): 479
• Promoter: CMV (from vector)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspEI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GGCATCAAGGTGAACTTCAAGA
• 3′ sequencing primer: ACAGGATGTCCCAGGCGAA

Gene/Insert 2

• Gene/Insert name: K(AAA)20
• Insert Size (bp): 103
• Promoter: CMV (from vector)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: GGCATCAAGGTGAACTTCAAGA
• 3′ sequencing primer: ACAGGATGTCCCAGGCGAA

Gene/Insert 3

• Gene/Insert name: P2A-mCherry
• Insert Size (bp): 795
• Promoter: CMV (from vector)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGCATCAAGGTGAACTTCAAGA
• 3′ sequencing primer: ACCACAACTAGAATGCAG

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry