-
PurposeDouble fluorescent stalling reporter K0
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105686 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 6006
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameP2A-3xFLAG-VHPbeta
-
SpeciesSynthetic
-
Insert Size (bp)479
- Promoter CMV (from vector)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BspEI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
- 3′ sequencing primer ACAGGATGTCCCAGGCGAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameK0
-
Insert Size (bp)43
- Promoter CMV (from vector)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
- 3′ sequencing primer ACAGGATGTCCCAGGCGAA (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameP2A-mCherry
-
Insert Size (bp)795
- Promoter CMV (from vector)
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GGCATCAAGGTGAACTTCAAGA
- 3′ sequencing primer ACCACAACTAGAATGCAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmGFP-P2A-K0-P2A-RFP was a gift from Ramanujan Hegde (Addgene plasmid # 105686 ; http://n2t.net/addgene:105686 ; RRID:Addgene_105686) -
For your References section:
Initiation of Quality Control during Poly(A) Translation Requires Site-Specific Ribosome Ubiquitination. Juszkiewicz S, Hegde RS. Mol Cell. 2017 Feb 16;65(4):743-750.e4. doi: 10.1016/j.molcel.2016.11.039. Epub 2017 Jan 5. 10.1016/j.molcel.2016.11.039 PubMed 28065601