pAAV-CKIIa-stGtACR2-FusionRed
(Plasmid #105669)

• Purpose: Expresses a soma-targeted GtACR2 in mammalian neurons under the CaMKIIa promoter
• Depositing Lab: Ofer Yizhar
• Publication: Mahn et al Nat Commun. 2018 Oct 8;9(1):4125. doi: 10.1038/s41467-018-06511-8.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 5360
• Total vector size (bp): 7211
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Use recA deficient growth strain to prevent homologous recombination.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: stGtACR2
• Alt name: soma-targeted Guillardia theta anion-conducting channelrhodopsin 2
• Species: Synthetic; Guillardia theta
• Insert Size (bp): 1851
• Promoter: CaMKIIa
• Tags / Fusion Proteins:
  • FusionRed (C terminal on backbone)
  • Kv2.1 (C terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GATGCTGACGAAGGCTCGC
• 3′ sequencing primer: CACATAGCGTAAAAGGAGCAAC

Resource Information

• Supplemental Documents:
  • D401_pAAV-CKIIa-GtACR2-ts-FRed-Kv2.1.gb
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Information for AAV1 (Catalog # 105669-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV-CKIIa-stGtACR2-FusionRed (#105669). In addition to the viral particles, you will also receive purified pAAV-CKIIa-stGtACR2-FusionRed plasmid DNA.

CaMKIIa-driven, soma-targeted anion-conducting channelrhodopsin fused to FusionRed for optogenetic inhibition. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: FusionRed

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Information for AAV Retrograde (Catalog # 105669-AAVrg)

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-CKIIa-stGtACR2-FusionRed (#105669). In addition to the viral particles, you will also receive purified pAAV-CKIIa-stGtACR2-FusionRed plasmid DNA.

CaMKIIa-driven, soma-targeted anion-conducting channelrhodopsin fused to FusionRed for optogenetic inhibition. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
• Buffer: PBS + 0.001% Poloxamer 188 + 200 mM NaCl
• Serotype: AAV retrograde (AAVrg)
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: FusionRed

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.