TRIN-E-shTAF12.364
(Plasmid
#105572)
-
PurposeDox-inducible mir30 MYB shRNA/dsRED expression with GFP marker and neo resistance
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105572 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneTRE-dsRED/mirE-shRNA-PGK-venus-IRES-neo
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTAF12 shRNA
-
gRNA/shRNA sequenceTGCTGTTGACAGTGAGCGACAGGTATTGACCAAGAAGAAATAGTGAAGCCACAGATGTATTTCTTCTTGGTCAATACCTGGTGCCTACTGCCTCGGA
-
SpeciesM. musculus (mouse)
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TGT TTG AAT GAG GCT TCA GTA C (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRIN-E-shTAF12.364 was a gift from Christopher Vakoc (Addgene plasmid # 105572 ; http://n2t.net/addgene:105572 ; RRID:Addgene_105572) -
For your References section:
A TFIID-SAGA Perturbation that Targets MYB and Suppresses Acute Myeloid Leukemia. Xu Y, Milazzo JP, Somerville TDD, Tarumoto Y, Huang YH, Ostrander EL, Wilkinson JE, Challen GA, Vakoc CR. Cancer Cell. 2018 Jan 8;33(1):13-28.e8. doi: 10.1016/j.ccell.2017.12.002. 10.1016/j.ccell.2017.12.002 PubMed 29316427