pGEMHE-NLS-mEGFP
(Plasmid #105527)

• Purpose: T7 promotor drives in vitro mRNA transcription of a mEGFP with a nuclear localisation signal
• Depositing Lab: Melina Schuh
• Publication: Clift et al Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033.

Backbone

• Vector backbone: pGEMHE
• Backbone size w/o insert (bp): 3819
• Total vector size (bp): 3898
• Vector type: in vitro Transcription

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Nucleoplasmin
• Insert Size (bp): 69
• Mutation: NLS of nucleoplasmin (encoding amino acids KRPAATKKAGQAKKKKL)
• Promoter: T7
• Tag / Fusion Protein:
  • mEGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: AgeI (not destroyed)
• 5′ sequencing primer: AAGGCGATTAAGTTGGGTAACG
• 3′ sequencing primer: CGTCGCCGTCCAGCTCGACCAG

Resource Information

• Supplemental Documents:
  • pGEMHE-NLS(NP)-mEGFP.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry