pGEMHE-membrane-mEGFP
(Plasmid #105526)

• Purpose: T7 promotor drives in vitro mRNA transcription of a mEGFP-tagged membrane reporter
• Depositing Lab: Melina Schuh
• Publication: Clift et al Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033.

Backbone

• Vector backbone: pGEMHE
• Backbone size w/o insert (bp): 3112
• Total vector size (bp): 3889
• Vector type: in vitro Transcription

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GNAI2
• Alt name: GIPB
• Alt name: H_LUCA15.1
• Alt name: H_LUCA16.1
• Species: H. sapiens (human)
• Mutation: fragment encoding the plasma membrane targeting sequence (’Membrane’) from Human GNAI2 consisting of the N-terminal amino acids 1-15 (nt 1-45) (which includes N-myristol and S-palmitoyl motifs for targeting and retention at plasma mebrane) in frame with mEGFP
• GenBank ID: NC_000003.12
• Entrez Gene: GNAI2 (a.k.a. GIP, GNAI2B, HG1C, H_LUCA15.1, H_LUCA16.1)
• Promoter: T7
• Tag / Fusion Protein:
  • mEGFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: AAGGCGATTAAGTTGGGTAACG
• 3′ sequencing primer: TCGGGTGTTCTTGAGGCTGG

Resource Information

• Supplemental Documents:
  • pGEMHE-membrane-mEGFP.gb
  • pGEMHE-membrane-mEGFP.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry