Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEMHE-mCherry-mTrim21ΔPRYSPRY
(Plasmid #105524)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105524 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEMHE
  • Backbone size w/o insert (bp) 3807
  • Total vector size (bp) 4653
  • Vector type
    in vitro Transcription

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRIM21
  • Alt name
    Ro52
  • Alt name
    Ssa1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    846
  • Mutation
    deletion of PRYSPRY domain (aa1-281)
  • GenBank ID
    NM_001082552.2
  • Entrez Gene
    Trim21 (a.k.a. Ro52, Ssa1)
  • Promoter T7
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CCCCGTAATGCAGAAGAAGA
  • 3′ sequencing primer TCGGGTGTTCTTGAGGCTGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Trim sequence was originally cloned by Leo James/William McEwan also MRC Laboratory of Molecular Biology
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEMHE-mCherry-mTrim21ΔPRYSPRY was a gift from Melina Schuh (Addgene plasmid # 105524 ; http://n2t.net/addgene:105524 ; RRID:Addgene_105524)
  • For your References section:

    A Method for the Acute and Rapid Degradation of Endogenous Proteins. Clift D, McEwan WA, Labzin LI, Konieczny V, Mogessie B, James LC, Schuh M. Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033. 10.1016/j.cell.2017.10.033 PubMed 29153837