pmCherry-C1-mTrim21
(Plasmid #105516)

• Purpose: Expression of m-Cherry-tagged wildtype mouse Trim21 in mammalian cells
• Depositing Lab: Melina Schuh
• Publication: Clift et al Cell. 2017 Nov 13. pii: S0092-8674(17)31255-2. doi: 10.1016/j.cell.2017.10.033.

Backbone

• Vector backbone: pmCherry-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4694
• Total vector size (bp): 6083
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TRIM21
• Alt name: Ro52
• Alt name: Ssa1
• Species: M. musculus (mouse)
• Insert Size (bp): 1389
• GenBank ID: NM_001082552.2
• Entrez Gene: Trim21 (a.k.a. Ro52, Ssa1)
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CCCCGTAATGCAGAAGAAGA
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • pmCherry-C1-Trim21_DNA.gb
• A portion of this plasmid was derived from a plasmid made by: Trim sequence was originally cloned by Leo James/William McEwan also MRC Laboratory of Molecular Biology

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The sequence contains an E318K in mTrim21. This mutation does not affect plasmid function as described in the associated publication.