Skip to main content
Addgene

pCK021
(Plasmid #105380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105380 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pICH41295 (Engler et al., 2014)
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    promotor SOMBRERO (At1g79580; 3300bp)
  • Species
    A. thaliana (mustard weed)
  • Mutation
    BsaI/ BpiI restriction sites removed

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BpiI (destroyed during cloning)
  • 3′ cloning site BpiI (destroyed during cloning)
  • 5′ sequencing primer CTTTGAGTGAGCTGATACCG
  • 3′ sequencing primer GGGTTCCGCGCACATTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCK021 was a gift from Johannes Stuttmann (Addgene plasmid # 105380 ; http://n2t.net/addgene:105380 ; RRID:Addgene_105380)
  • For your References section:

    Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system. Gantner J, Ordon J, Ilse T, Kretschmer C, Gruetzner R, Lofke C, Dagdas Y, Burstenbinder K, Marillonnet S, Stuttmann J. PLoS One. 2018 May 30;13(5):e0197185. doi: 10.1371/journal.pone.0197185. eCollection 2018. 10.1371/journal.pone.0197185 PubMed 29847550