Skip to main content
Addgene

pGP-AAV-CAG-FLEX-jGCaMP7c variant 1513-WPRE
(Plasmid #105323)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105323 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV-CAG-FLEX
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 5027
  • Total vector size (bp) 6380
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    jGCaMP7c variant 1513
  • Alt name
    GCaMP3-L59Q E60P T302L R303P M378G K379S D380Y T381R R392G T412N
  • Alt name
    GCaMP3 variant 1513
  • Alt name
    Janelia GCaMP7
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
    1353
  • Promoter CAG
  • Tag / Fusion Protein
    • T7 epitope, Xpress tag, 6xHis

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGP-AAV-CAG-FLEX-jGCaMP7c variant 1513-WPRE was a gift from Douglas Kim & GENIE Project (Addgene plasmid # 105323 ; http://n2t.net/addgene:105323 ; RRID:Addgene_105323)
  • For your References section:

    High-performance calcium sensors for imaging activity in neuronal populations and microcompartments. Dana H, Sun Y, Mohar B, Hulse BK, Kerlin AM, Hasseman JP, Tsegaye G, Tsang A, Wong A, Patel R, Macklin JJ, Chen Y, Konnerth A, Jayaraman V, Looger LL, Schreiter ER, Svoboda K, Kim DS. Nat Methods. 2019 Jul;16(7):649-657. doi: 10.1038/s41592-019-0435-6. Epub 2019 Jun 17. 10.1038/s41592-019-0435-6 PubMed 31209382