Skip to main content
Addgene

pEGFP Kindlin2
(Plasmid #105305)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105305 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-NV
  • Backbone manufacturer
    modified pEGFP-N1. GFP is in BamH1 and Not 1 sites
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kindlin2
  • Alt name
    FERMT2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2100
  • GenBank ID
    NM_006832
  • Entrez Gene
    FERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer AATGTCGTAACAACTCCGCCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Original Kindlin 2 (FERMT2) cDNA was from OriGene, Cat no. SC320413.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP Kindlin2 was a gift from Kenneth Yamada (Addgene plasmid # 105305 ; http://n2t.net/addgene:105305 ; RRID:Addgene_105305)
  • For your References section:

    Dense fibrillar collagen is a potent inducer of invadopodia via a specific signaling network. Artym VV, Swatkoski S, Matsumoto K, Campbell CB, Petrie RJ, Dimitriadis EK, Li X, Mueller SC, Bugge TH, Gucek M, Yamada KM. J Cell Biol. 2015 Feb 2;208(3):331-50. doi: 10.1083/jcb.201405099. 10.1083/jcb.201405099 PubMed 25646088