pECFP-Cdc42Q61L
(Plasmid #105294)

• Purpose: Constitutively active Cdc42
• Depositing Lab: Kenneth Yamada
• Publication: Petrie et al J Cell Biol. 2012 Apr 30;197(3):439-55. doi: 10.1083/jcb.201201124.

Backbone

• Vector backbone: pECFP-C1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cdc42
• Alt name: CDC42
• Species: H. sapiens (human)
• Mutation: Q61L
• Entrez Gene: CDC42 (a.k.a. CDC42Hs, G25K, TKS)
• Tag / Fusion Protein:
  • CFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (unknown if destroyed)
• 3′ cloning site: BamH1 (unknown if destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Human Cdc42 sequence cloned with a nucleotide (C) added to the 5' end to keep it in frame. Amino acid Q at position 61 of the protein sequence is mutated to L. The insert was from Dr. Natalie Lamarche-Vane (McGill University).