Ypet-RBD
(Plasmid #105291)

• Purpose: To measure Rho activity by binding and FRET analysis
• Depositing Lab: Kenneth Yamada
• Publication: Petrie et al J Cell Biol. 2012 Apr 30;197(3):439-55. doi: 10.1083/jcb.201201124.

Backbone

• Vector backbone: pYPet-C1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: RBD
• Alt name: Rtkn
• Species: M. musculus (mouse)
• Mutation: aa encoding 7-89
• Entrez Gene: Rtkn
• Tag / Fusion Protein:
  • Ypet (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (unknown if destroyed)
• 3′ cloning site: BamH1 (unknown if destroyed)
• 5′ sequencing primer: CATGGTCCTGCTGGAGTTCGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Subcloned the sequence encoding amino acids 7-89 (an additional nucleotide (T) to the 5' end keep it in frame) of mouse Rhotekin into the EcoRI-BamH1 sites of pYPet-C1. The insert was from Dr. Natalie Lamarche-Vane (McGill University).