pLIX403_UBAP2L_mCherry
(Plasmid #105286)

• Purpose: puro-selectable lentivirus vector for inducible expression of a UBAP2L-mCherry fusion protein
• Depositing Lab: Eugene Yeo
• Publication: Markmiller et al Cell. 2018 Jan 25;172(3):590-604.e13. doi: 10.1016/j.cell.2017.12.032.

Backbone

• Vector backbone: pLIX403
• Backbone manufacturer: Addgene plasmid 41393
• Backbone size w/o insert (bp): 9396
• Total vector size (bp): 11752
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: UBAP2L
• Species: H. sapiens (human)
• Insert Size (bp): 3261
• GenBank ID: NM_014847.3
• Entrez Gene: UBAP2L (a.k.a. NICE-4, NICE4)
• Promoter: TRE promoter, Tet ON
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: LNCX
• 3′ sequencing primer: O.PGK1b-R (GAACGGACGTGAAGAATGTG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry