hIRF-1 gRNA #351 (Sa)
(Plasmid
#105283)
-
PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105283 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBPK2660
-
Backbone manufacturerKeith Joung (Addgene plasmid #70709)
- Backbone size w/o insert (bp) 2288
- Total vector size (bp) 2287
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA_hIRF1 promoter #351
-
gRNA/shRNA sequenceccagtgggatatcaagaagg
-
SpeciesH. sapiens (human)
-
Insert Size (bp)555
-
GenBank ID
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmB I (destroyed during cloning)
- 3′ cloning site BsmB I (destroyed during cloning)
- 5′ sequencing primer LKO.1 5' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKeith Joung (Addgene plasmid 70709)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hIRF-1 gRNA #351 (Sa) was a gift from Hodaka Fujii (Addgene plasmid # 105283 ; http://n2t.net/addgene:105283 ; RRID:Addgene_105283) -
For your References section:
enChIP systems using different CRISPR orthologues and epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4. 10.1186/s13104-018-3262-4 PubMed 29482606