YIplac204-T|C-iGFP-RCY1
(Plasmid
#105281)
-
PurposeOverexpresses iGFP-RCY1 from the TPI1 promoter. Integrating at TRP1.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105281 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneYIplac204-TC
- Backbone size w/o insert (bp) 4108
- Total vector size (bp) 7666
-
Modifications to backboneIncludes TPI1 promoter and CYC1 terminator
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRcy1
-
SpeciesS. cerevisiae (budding yeast)
-
Entrez GeneRCY1 (a.k.a. YJL204C)
- Promoter TPI1
-
Tag
/ Fusion Protein
- iGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI/XmaI (destroyed during cloning)
- 3′ cloning site HpaI/XbaI (unknown if destroyed)
- 5′ sequencing primer M13 REVERSE
- 3′ sequencing primer CGAGCTCGGTACCCGGTCGCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
YIplac204-T|C-iGFP-RCY1 was a gift from Benjamin Glick (Addgene plasmid # 105281 ; http://n2t.net/addgene:105281 ; RRID:Addgene_105281) -
For your References section:
Budding Yeast Has a Minimal Endomembrane System. Day KJ, Casler JC, Glick BS. Dev Cell. 2018 Jan 8;44(1):56-72.e4. doi: 10.1016/j.devcel.2017.12.014. Epub 2018 Jan 8. 10.1016/j.devcel.2017.12.014 PubMed 29316441