sgPYM1
(Plasmid
#105249)
-
Purposehuman PYM1 sgRNA
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 105249 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX458
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA for PYM1
-
gRNA/shRNA sequencegcgtcaacacagcgacctga
-
SpeciesH. sapiens (human)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgPYM1 was a gift from Geraldine Seydoux (Addgene plasmid # 105249 ; http://n2t.net/addgene:105249 ; RRID:Addgene_105249) -
For your References section:
Precision genome editing using synthesis-dependent repair of Cas9-induced DNA breaks. Paix A, Folkmann A, Goldman DH, Kulaga H, Grzelak MJ, Rasoloson D, Paidemarry S, Green R, Reed RR, Seydoux G. Proc Natl Acad Sci U S A. 2017 Nov 28. pii: 1711979114. doi: 10.1073/pnas.1711979114. 10.1073/pnas.1711979114 PubMed 29183983