pKM126
(Plasmid #105134)

• Purpose: Clostridium difficile CRISPR-cas9 mutagenesis plasmid Tn916 oriT
• Depositing Lab: Joseph Sorg
• Publication: McAllister et al Sci Rep. 2017 Nov 7;7(1):14672. doi: 10.1038/s41598-017-15236-5.

Backbone

• Vector backbone: pJS116
• Backbone size w/o insert (bp): 6324
• Modifications to backbone: Addition of Cas9 (codon optimized for C. difficile expression), tetR, region of homology for pyrE deletion, gRNA, gdh promoter
• Vector type: E. coli - C. difficile shuttle vector

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Upstream & Downstream pyrE deletion region
• Species: C. difficile
• Insert Size (bp): 2000

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caggaaacagctatgacc
• 3′ sequencing primer: tctgcaggcctcgag

Gene/Insert 2

• Gene/Insert name: tetR
• Insert Size (bp): 624

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ctcgaggcctgcaga
• 3′ sequencing primer: caatgatataatgtcaacaaaaaggagga

Gene/Insert 3

• Gene/Insert name: Cas9
• Species: S. pyogenes
• Insert Size (bp): 4107

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcttgatcgtagcgttaacagatc
• 3′ sequencing primer: tgtaaaacgacggccagt

Gene/Insert 4

• Gene/Insert name: gRNA
• Insert Size (bp): 140

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaaactataaaaaaaattgaagacatacaacagac

Resource Information

• Supplemental Documents:
  • pKM126.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry