CMV-Y-GECO2m
(Plasmid #105070)

• Purpose: A yellow fluorescent Ca2+ indicator variant with medium binding affinity and kinetics for expression in mammalian cells
• Depositing Lab: Robert Campbell
• Publication: Zhao et al Sci Rep. 2018 Aug 6;8(1):11758. doi: 10.1038/s41598-018-30080-x.

Backbone

• Vector backbone: Customized Vector
• Backbone size w/o insert (bp): 3302
• Total vector size (bp): 4565
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Y-GECO2m
• Species: Synthetic
• Insert Size (bp): 1263
• GenBank ID: MG450564
• Promoter: CMV
• Tag / Fusion Protein:
  • 6x His tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This gene is a variant of CMV-Y-GECO1 (Plasmid #55766)