Skip to main content
Addgene

pTorPE-Y-GECO2.2s
(Plasmid #105069)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 105069 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Customized Vector
  • Backbone size w/o insert (bp) 4118
  • Total vector size (bp) 5489
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Y-GECO2.2s
  • Species
    Synthetic
  • Insert Size (bp)
    1371
  • GenBank ID
    MG520328
  • Promoter pBAD
  • Tag / Fusion Protein
    • 6x His tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCCATAGCATTTTTATCC
  • 3′ sequencing primer GATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This gene is a variant of pTorPE-Y-GECO1 (Plasmid #55765)

Addgene NGS results found F261V in the araC translation. The depositing laboratory believes that this is not a problem for araC or plasmid function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTorPE-Y-GECO2.2s was a gift from Robert Campbell (Addgene plasmid # 105069 ; http://n2t.net/addgene:105069 ; RRID:Addgene_105069)
  • For your References section:

    Inverse-response Ca(2+) indicators for optogenetic visualization of neuronal inhibition. Zhao Y, Bushey D, Zhao Y, Schreiter ER, Harrison DJ, Wong AM, Campbell RE. Sci Rep. 2018 Aug 6;8(1):11758. doi: 10.1038/s41598-018-30080-x. 10.1038/s41598-018-30080-x PubMed 30082904